[ Article ]

Korean Journal of Medicinal Crop Science - Vol. 30, No. 6, pp.411-418

ISSN: 1225-9306 (Print) 2288-0186 (Online)

Print publication date 31 Dec 2022

Received 16 Sep 2022 Revised 28 Nov 2022 Accepted 28 Nov 2022

DOI: https://doi.org/10.7783/KJMCS.2022.30.6.411

층층잔대 수집자원의 형태적 특성과 SSR마커를 이용한 유전다양성 분석

정대희¹^{, ^#} ; 엄유리²^{, ^#} ; 윤영배³ ; 허정훈⁴ ; 김지아⁵ ; 박홍우⁶^{, †}

1국립산림과학원 산림약용자원연구소 연구원
2국립산림과학원 산림약용자원연구소 연구사
3국립산림과학원 산림약용자원연구소 연구원
4국립산림과학원 산림약용자원연구소 연구원
5국립산림과학원 산림약용자원연구소 연구사
6국립산림과학원 산림약용자원연구소 연구사

Investigation of Morphological Characteristics and Genetic Diversity of Adenophora triphylla (Thunb.) A. DC. Using SSR Markers

Dae Hui Jeong¹^{, ^#} ; Yurry Um²^{, ^#} ; Yeong Bae Yun³ ; Jeong Hoon Huh⁴ ; Jiah Kim⁵ ; Hong Woo Park⁶^{, †}

1Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea
2Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea
3Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea
4Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea
5Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea
6Researcher, Medicinal Resources Research Center, National Institute of Forest Science, Yeongju 36040, Korea

Correspondence to: ^†(Phone) +82-54-630-5649 (E-mail) redrain39@korea.kr ^#Dae Hui Jeong and Yurry Um are contributed equally to this paper

This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Adenophora triphylla (Thunb.) A. DC. is used for food and medicinal purposes in Eastern Asia including the Republic of Korea.

Methods and Results

There have been no studies on the genetic diversity of A. triphylla. The aim of this study was to investigate the genetic diversity of A. triphylla resources using simple sequence repeat (SSR) markers and to provide basic data for the molecular breeding of A. triphylla. Using eight SSR markers, the genetic diversity of 40 A. triphylla resources was found to be different in various cultivation areas. Genetic analysis using the eight SSR markers revealed a high level of diversity among the genetic resources. In the unweighted pair group method with arithmetic mean cluster analysis, the 40 A. triphylla genetic resources were divided into clade A and clade B. In clade A, the external morphological characteristics (stem color, leaf shape, and flower color) were identical; however, in clade B, a mixed pattern was observed.

Conclusions

These results may be used as basic data for molecular breeding to identify origin of plants and analyze their relationships using SSR markers.

Keywords:

Adenophora triphylla (Thunb.) A. DC., Genetic Diversity, Morphological Characteristics, Simple Sequence Repeats

서 언

층층잔대 [Adenophora triphylla (Thunb.) A. DC.]는 초롱꽃과 (Campanulaceae), 잔대속 (Genus Adenophora)에 속하는 다년생 식물로서 (Oh, 1981; Yoo, 1995), 국내를 비롯한 중국, 일본, 타이완 등 아시아지역에 널리 분포되어 있으며, 주로 약용식물로 사용되고 있다 (CPC, 2010; JMHLW, 2011; KFDA, 2012).

식물분류학적으로 층층잔대와 잔대 (A. triphylla var. japonica)는 악열편 (calyx lobe)에 거치 (serrate)의 유무와 판연 (corolla limb)의 벌어짐 정도로 구분할 수 있다 (Lee and Lee, 1994). 국내에서는 대부분의 층층잔대가 잔대로 명칭하여 재배하고 있으며 (Fig. 1), 잔대의 뿌리 추출물은 항돌연변이성 및 항종양, 항염증 효과가 있다고 밝혀져 있다 (Yang, 2008; Ham et al., 2009).

Fig. 1.

Photograph of A. triphylla and A. triphylla var. japonica.(A); A. triphylla (Thunb.) A. DC., (B); A. triphylla var. japonica.

약용으로 활용하는 잔대속 식물의 기원을 정립하기 위한 연구에서는 식물의 외부형태의 차이에 따른 외부형태학적 연구 (Lee and Lee, 1994) 및 화학분류학적 연구 (Kim et al., 2017)가 주로 수행되어져 왔다. 그러나, 잔대속 식물들은 약용의 목적으로 한약재로 사용가능한 형태인 건조후 절편 또는 분말로 가공처리하기 때문에 외부형태적 또는 이화학적 분류를 통하여서는 그 기원식물의 동정에 어려움이 있다 (Choi et al., 2013; Kim et al., 2017).

최근에는 이러한 형태적 또는 이화학적 분류 방법의 한계를 보완하고 기원식물의 종판별 결과의 신뢰도를 향상시킬 수 있는 다양한 분자생물학적 판별법이 개발되어 활용되고 있다 (Moon et al., 2013; Kim et al., 2014). 특히 중합효소 연쇄반응 (polymerase chain reaction; PCR) 기법을 이용한 single nucleotide polymorphism (SNP), random amplified polymorphic DNA (RAPD), simple sequence repeat (SSR) 등 소량의 DNA를 이용한 유전다양성 분석 방법은 식물체의 부위와 생육 정도에 관계없이 모든 조직에서 안정적이고 비교적 적은 비용으로 기원식물을 판별할 수 있다는 장점을 가진다 (Jo et al., 2013).

이들 중에서도 SSR을 이용한 품종별 유전적 다양성을 분석하는 방법은 분석이 비교적 쉽고 재현성이 높기 때문에 연구자들에게 높은 선호도를 보인다. 선행연구에서는 SSR 마커를 이용하여 당귀 (Angelica gigas Nakai) 및 작약 [Docynia delavayi (Franch.) Schneid], 국화 (Chrysanthemum morifolium)에서 유전다양성 및 유연관계 등에 관한 결과를 보고하였다 (Cheng et al., 2011; Khaing et al., 2013; Peng et al., 2021). 특히, 본 연구에서 사용하는 SSR 마커는 잔대 (A. triphylla var. japonica (Regel) H. Hara)에서 개발하였다 (Park et al., 2017).

따라서, 본 연구는 수집한 층층잔대의 유전적 다양성을 선행연구자에 의해 개발된 유전체 기반의 SSR 마커를 이용하여 기원식물을 판별하고 유연관계를 분석함으로써, 분자육종의 기초자료로 제공하고자 수행하였다.

재료 및 방법

1. 공시재료 및 형태적 특성 조사

실험에 사용된 층층잔대 [A. triphylla (Thunb.) A. DC.]의 수집은 2019 년 7 월부터 2020 년 8 월까지 6 지역의 자생지에서 13 점 (충북 충주시 4 점, 인천 강화군 3 점, 경북 안동시 3 점, 충북 제천시 1 점, 경북 봉화군 1 점, 충남 태안군 1 점), 2 지역의 재배지에서 27 점 (충남 금산군 10 점, 경북 영주시 17 점) 등 총 40 점을 수집하였으며, 지역적 정보는 Table 1에 정리하였다.

Table 1.

Collection of A. triphylla (Thunb.) A. DC. accessions from different in Korea.

그리고 외부형태적 변이폭을 조사하기 위해 개화 시기인 8월에 잎차례, 잎형태, 줄기색 등의 정성적 형질 특성을 조사하였으며, 줄기색은 RHS 컬러차트 (RHS colour chart, Royal Horticultural Society, England)에 근거하여 색을 구분하였다.

2. DNA 추출

DNA 추출을 위해 시료별 잎 100 ㎎을 동결건조하여 분쇄 후 –80℃ 초저온냉동고 (IlShinBioBase Co., Ltd., Dong-ducheon, Korea)에 보관하였다. 유전 다양성 검정을 위한 DNA는 DNeasy Plant mini Kit (QIAGEN, Tokyo, Japan)의 방법에 따라 추출하였으며, 추출된 DNA는 DeNovix DS-11 + spectrophotometer (DeNovix Inc., Wilmington, DE, USA)으로 정량하였고 농도를 10 ㎍/㎕로 조정하여 사용하였다.

3. SSR 마커 선발 및 fragment analysis

층층잔대의 유전체 기반 SSR 마커를 적용하기 위해 선행연구자 (Park et al., 2017)에 의해 개발된 39 개 SSR 마커 중 allele 수 및 PIC 값이 가장 높은 8 개 프라이머 세트를 선발하였다 (Table 2).

Table 2.

Characterization of 8 SSR markers validated in 40 A. triphylla (Thunb.) A. DC. accessions.

DNA fragment analysis를 활용하기 위해 선발된 마커 8세트의 각 forward 프라이머에 형광다이 (FAM, HEX, TAMRA, CY5)를 부착하여 제작 후 사용하였다 (Macrogen Co., Korea).

PCR 반응액의 총 부피는 50 ㎕로, 10 ng genomic DNA, 1 × extraction buffer, 1 μM primer, 0.2 mM dNTPs, 그리고 0.5 unit Ex Taq DNA polymerase (Takara Bio Inc., Otsu, Japan)로 반응하였다. PCR 반응은 C1000 Touch^™ Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA)를 이용하였다. PCR 조건은 95℃에서 5 분간 pre-denaturation한 후, 95℃에서 45 초, 55℃ - 60℃에서 45 초, 72℃에서 45 초로 35 cycles로 수행하였고, final extention 과정은 72℃에서 10 분간 반응시켰다.

증폭된 DNA 산물은 2.5% agarose gel에서 100 V로 전기 영동한 후, Safe Gel Stain (Inclone, Seoul, Korea)로 염색하여 gel documentation system (Gel Doc^™ XR + System, Bio-Rad Laboratories Inc., Hercules, CA, USA)에서 PCR 증폭산물을 확인하였다. 확인된 PCR 증폭산물 0.2 ㎕에 9.8 ㎕의 Hi-Di formamide (Applied Biosystems, Foster, CA, USA), 0.2 ㎕의 GeneScan™ 500 LIZ® size standard (Applied Biosystems, Foster, CA, USA)를 혼합하였다. 혼합물은 95℃에서 5 분간 변성시킨 후 얼음에 방치하였다.

증폭된 DNA 절편은 50 ㎝ 모세관이 장착된 ABI 3730 DNA analyzer (Applied Biosystems, Foster, CA, USA) 상에서 모세관 전기영동을 통해 DNA 절편들을 분리하였다. 대립 유전자들의 크기는 GeneMapper 소프트웨어 (v4.0; Applied Biosystems, Foster, CA, USA)를 이용하여 분석하였다.

4, 유전적 다양성 및 유연관계 분석

층층잔대 개체별로 각 마커에서 PCR 증폭산물의 유무에 따라 ‘1’과 ‘0’으로 표시하여 매트릭스로 변환하였으며, 추출한 RFU 값이 2,000 이하인 증폭산물은 제외하고 분석하였다.

분석한 결과는 PowerMarker software (v.3.25: Liu and Muse, 2005)를 이용하여 정리하였으며, 층층잔대 유전자원 40점의 유연관계 분석은 NTSTS-pc 2.10 프로그램 (Exeter Software, Setauket, NY, USA)을 이용하여 수행하였다. 프로그램 내 옵션을 SIMQUAL로 설정하여 수행하였으며, UPGMA 알고리즘을 통해 도출된 데이터로 SHAN 클러스터링을 거쳐 dendrogram을 작성하여 유전적 유연관계를 분석하였다.

결과 및 고찰

1. 유전체 기반 SSR 마커를 이용한 층층잔대 수집자원 유전자형 분석

층층잔대 [A. triphylla (Thunb.) A. DC.] 수집자원의 유전자형 분석을 위하여 선발한 8 개 SSR 마커의 motif는 Table 3과 같이 3 개 염기가 7 번 반복되거나 (Atri00959, Atri01120, Atri04190) 4 개의 염기가 5 번 반복 (Atri00021, Atri00095, Atri00108, Atri00146,), 5 개의 염기가 5 번 반복되는 (Atri00245) 염기서열을 가지고 있었다.

Table 3.

Diversity statistics from 8 SSR markers in 40 A. triphylla (Thunb.) A. DC. accessions.

선발한 8 개의 마커를 이용하여 PCR을 수행하였고, 증폭된 산물은 ABI 3730 DNA Analyzer (Applied Biosystems, Foster, CA, USA)을 이용하여 40 점의 층층잔대 유전자원의 유전형을 분석하였다 (Fig. S1). PCR fragment analyzer 분석은 형광 dye가 결합된 primer를 제작하고, 증폭산물을 만들어 형광 물질의 양을 측정하는 방법과 비교하여 실험과정을 보다 간단하게 하여 빠른 시간 내에 결과를 도출할 수 있다 (Park et al., 2016).

각각의 마커들에 대하여 PowerMarker software를 이용한 PCR fragment analyzer 분석 결과를 Table 3에 정리하였다. 각 마커별 가장 많이 증폭되는 allele의 빈도수 (major allele frequency, MAF)는 0.225 – 0.7375로 평균 0.5016으로 나타났다. 각 마커에서 나타나는 allele의 수 (number of allele, N_A)는 Atri00021 8 개, Atri00095 7 개, Atri00108 12 개, Atri00146 12 개, Atri00245 14 개, Atri00959 5 개, Atri01120 6 개, Atri01490 13 개의 allele이 있는 것으로 나타났다.

따라서, 본 연구에서 개발된 층층잔대 유전체 기반 SSR 마커에서는 총 131 개의 allele이 출현하였으며, 평균적으로 9.625개의 allele이 나타나는 것으로 분석되었다. 예상이형접합도 (expected heterozygosity, H_E)는 각 마커를 통하여 분석된 전체 개체 중에서 이형접합을 보일 것으로 예상되는 개체의 비율을 말하며, Atri00245 > Atri00108 > Atri00021 > Atri00095 > Atri00146 > Atri01490 > Atri01120 > Atri00959 마커 순으로 0.4272 – 0.8828 사이의 값을 가졌으며 평균 0.6641으로 나타났다. 분석한 샘플 중에서 실제 이형접합성을 보이는 샘플의 비율 (observed heterozygosity, H_O)은 0.300 – 0.825로 평균 0.5656으로 분석되었다.

다양성 요소 (polymorphism information content, PIC)의 평균값은 0.6401로 0.3954 – 0.8728 사이의 값을 나타내었으며, PIC 값이 0.5 이상이면 다형성 분석에 유익한 마커라고 보고함에 따라 (Kim et al., 2016) 층층잔대의 SSR 마커에서도 PIC 값이 0.5 이상인 마커에서 종 및 품종의 다형성 분석에 유익한 마커임을 밝혀냈다.

2. 계통도 작성을 통한 40 개 층층잔대 유전다양성 분석

SSR 마커는 QTL mapping, marker-assisted selection (MAS), linkage map 개발, cultivar fingerprinting, 유전자 합성경로 및 진화, 유전적 다양성 분석 연구 등을 포함하여 다양한 식물 과학 분야에서 사용되어 왔으며, 이를 통해 작물의 유전적 다양성과 유연관계를 밝혀내 품종 개발 및 육종에 있어 매우 효율적이고 경제적이다 (Cavagnaro et al., 2010; Zhu et al., 2011).

이러한 SSR 마커를 활용한 약용작물의 기원 및 분류를 위한 수집자원의 유전 다양성 분석은 기존의 분자유전학적 방법보다 재현성과 정확도가 높았으며, 유연관계 분석을 통해 기원식물을 구분하거나 시료 간의 효율적인 계통분류를 가능하게 하였다 (Bang et al., 2011; Li et al., 2011; Kim et al., 2014).

층층잔대에서 다형성을 가진 8 개의 SSR 마커를 이용하여 층층잔대의 유전형을 분석하였고, 그 결과를 이용하여 계통도를 작성하고 유연관계를 분석하였다. 안동, 봉화, 강화, 제천, 태안, 충주, 금산, 영주에서 수집된 40 개체의 층층잔대 유전자원 간의 유연관계를 분석한 결과, 수집지역별로 완벽하게 군집이 형성되지는 않았지만, 강화자생지 (KH-ade#3-1, KH-ade#3-2, KH-ade#3-3)와 봉화자생지 (BH-ade#05), 안동자생지 (AD-ade#3-5)에서 수집된 개체들은 하나의 분계군 (Clade A)을 형성하였다 (Fig. 2, Table 4). 그리고 Clade A에 속한 개체들의 외부형태적 형질도 잎차례 (Phyllotaxy)는 윤생 (alternate), 줄기는 밝은 녹색 (Light green-144C)으로 동일한 형태적 특성을 나타냈다. 그러나, B 분계군 (Clade B)에서는 지역적, 외부형태적으로 통일된 유집없이 여러 분계조 (Subclade)로 구분되어 혼재된 양상을 나타냈다. 층층잔대는 타식성 식물이며, 형태적 형질이나 유전적 변이가 매우 다양하여 완벽한 군집을 형성하기에는 다소 어려움이 있을 것으로 생각된다 (Kim and Yoo, 2012).

Fig. 2.

Dendrogram generated using UPGMA cluster analysis based on genetic diversity of 40 resources of A. triphylla (Thunb.) A. DC. accessions.The genetic distances between strains were calculated based on the shared allelic methods (Jin and Chakraborty, 1994) using PowerMarker v3.25 software.

Table 4.

Morphological characteristics of A. triphylla (Thunb.) A. DC. accessions collected from different area in Korea.

본 실험 또한 8 개의 마커를 통한 유전형 분석에서 매우 높은 다양성을 확인할 수 있었으며, 참당귀 (A. gigas)와 인삼 (Panax ginseng)을 대상으로 수행된 SSR marker 분석 연구 (Um et al., 2016; Jeong et al., 2019) 및 초롱꽃과 도라지 (Platycodon grandiflorum)의 microsatellite-marker 분석연구 (Song et al., 2012) 등과 같은 다른 작물에서 수행된 연구에서도 수집한 지역과 생육환경에 따라 높은 유전 다양성이 나타나 본 연구와 유사한 결과가 도출되었다. 따라서, 현재 자생지 및 재배지에서 생육하는 층층잔대의 유전적 고정이 진행되지 않았음을 나타내며, 산채, 약용 등으로 높은 활용성을 지닌 층층잔대의 활용성 증대와 품종 개발 연구를 위한 기초자료 확보를 위해 유전자 분석관련 연구가 지속적으로 수행되어야 할 것으로 판단된다.

본 연구에서는 8 개의 유전체 기반 SSR 마커를 이용하여 40 개 층층잔대 유전자원의 유전 다양성을 평가하고 유연관계를 확인하였다. 그 결과, 선발한 8 개의 마커는 높은 다형성을 나타내며, 층층잔대의 유전형을 세분화하여 식별할 수 있음을 확인하였다. 또한, 층층잔대가 타식성 식물이어서 지역적, 형태적으로 완벽한 군집을 형성하는 것을 어려우나, 본 연구의 결과에서는 유전형을 분석하여 계통도를 작성한 결과, 층층잔대의 유전자원은 A 와 B 분계군으로 나눌 수 있었으며, A 분계군에서는 잎차례와 줄기색 등의 외부형태적 형질이 동일하게 나타나는 것을 확인하였다.

이러한 결과는 기존의 다른 자원에서의 결과와 마찬가지로 층층잔대의 수집 지역과 생육환경에 따라 높은 유전 다양성을 보임을 알 수 있다. 본 연구의 결과를 바탕으로 향후 층층잔대의 분자육종을 위한 선발 마커로의 활용을 기대해 볼 수 있을 것이다.

Acknowledgments

본 연구는 국립산림과학원 “유망 산림약용자원 신품종 육성 및 기능성 소재 대량생산 기술 개발(FG0502-2017-01) 및 고품질 참당귀 품종육성 및 유망 약초류 표준재배기술 확립 연구(FP0802-2022-04)”의 지원에 의해 이루어진 결과로 이에 감사드립니다.

References

Bang KH, Jo IH, Chung JW, Kim YC, Lee JW, Seo AY, Park JH, Kim OT, Hyun DY, Kim DH and Cha SW. (2011). Analysis of genetic polymorphism of Korean ginseng cultivars and foreign accessions using SSR markers. Korean Journal of Medicinal Crop Science. 19:347-353. [https://doi.org/10.7783/KJMCS.2011.19.5.347]
Cavagnaro PF, Senalik DA, Yang L, Simon PW, Harkins TT, Kodria CD, Huang S and Weng Y. (2010). Genome-wide characterization of simple sequence repeats in cucumber (Cucumis sativus L.). BMC Genomics. 11:569-586. [https://doi.org/10.1186/1471-2164-11-569]
Cheng Y, Kim CH, Shin DI, Kim SM, Koo HM and Park YJ. (2011). Development of simple sequence repeat(SSR) markers to study diversity in the herbaceous peony(Paeonia lactiflora). Journal of Medicinal Plants Research. 5:6744-6751. [https://doi.org/10.5897/JMPR11.889]
Chinese Pharmacopoeia Commission(CPC). (2010). Pharmacopoeia of the people’s Republic of China 2010 edition. China Medical Science Press. Beijing, China. p.96-107.
Choi G, Kang YM, Moon BC and Kim HK. (2013). A comparative study about the origins of crude drugs in the Northeast Asian Pharmacopoeias: Centered on same name of materials but different genus. Korea Journal of Herbology. 28:103-111. [https://doi.org/10.6116/kjh.2013.28.5.103]
Ham YA, Choi HJ, Kim SH, Chung MJ and Ham SS. (2009). Antimutagenic and antitumor effects of Adenophora triphylla extracts. Journal of the Korean Society of Food Science and Nutrition. 38:25-31. [https://doi.org/10.3746/jkfn.2009.38.1.025]
Japanese Ministry of Health, Labour and Welfare(JMHLW). (2011). The Japanese Pharmacopoeia 16th edition. The Ministry of Health, Labour and Welfare Ministerial Notification No. 65. Japanese Ministry of Health, Labour and Welfare. Tokyo, Japan. p.162-170.
Jeong DH, Park YM, Kim KY, Park HW, Jeon KS, Kim MJ, Gil JS, Lee Y and Um Y. (2019). Genetic diversity of Angelica gigas Nakai collected in Korea using genome-wide SSR markers. Korean Journal of Medicinal Crop Science. 27:376-382. [https://doi.org/10.7783/KJMCS.2019.27.6.376]
Jin L and Chakraborty R. (1994). Estimation of genetic distance and coefficient of gene diversity from single-probe multilocus DNA fingerprinting data. Molecular Biology and Evolution. 11:120-127.
Jo IH, Bang KH, Kim YC, Kim JU, Shin MR, Moon JY, Noh BS, Hyun DY, Kim DH, Cha SW and Kim HS. (2013). Analysis of mitochondrial DNA sequence and molecular marker development for identification of Panax species. Korean Journal of Medicinal Crop Science. 21:91-96. [https://doi.org/10.7783/KJMCS.2013.21.2.91]
Khaing AA, Moe KT, Hong WJ, Park CS, Yeong KH, Park HS, Kim DC, Choi BJ, Jung JY, Chae SC, Lee KM and Park YJ. (2013). Phylogenetic relationships of chrysanthemums in Korea based on novel SSR markers. Genetics and Molecular Research. 12:5335-5347. [https://doi.org/10.4238/2013.November.7.8]
Kim HJ, Son DC, Kim HJ, Choi K, Oh SH and Kang SH. (2017). The chemotaxonomic classification of Korean Campanulaceae based on triterpene, sterol, and polyacetylene contents. Biochemical Systematics and Ecology. 74:11-18. [https://doi.org/10.1016/j.bse.2017.07.002]
Kim JH, Seo JW, Byeon JH, Ahn YS, Cha SW and Cho JH. (2014). Morphological characteristics and phylogenetic analysis of Polygonatum species based on chloroplast DNA sequences. Korean Journal of Medicinal Crop Science. 22:489-496. [https://doi.org/10.7783/KJMCS.2014.22.6.489]
Kim KA and Yoo KO. (2012). Phylogenetic relationships of Korean Campanulaceae based on chloroplast DNA sequences. Korean Journal of Plant Taxonomy. 42:282-293. [https://doi.org/10.11110/kjpt.2012.42.4.282]
Kim SR, Jeong JH, Chung H, Kim JH, Gil JS, Yoo JM, Um Y, Kim OT, Kim TD, Kim YY, Lee DH, Kim HB and Lee Y. (2016). Simple sequence repeat marker development from Codonopsis lanceolata and genetic relation analysis. Journal of Plant Biotechnology. 43:181-188. [https://doi.org/10.5010/JPB.2016.43.2.181]
Korea Food & Drug Administration(KFDA). (2012). The Korean herbal pharmacopoeia. The KFDA Notification No. 2012-135. Korea Food and Drug Administration. Cheongju, Korea. p.67-83.
Lee JK and Lee ST. (1994). A taxonomic study of the genus Adenophora in Korea. Sung Kyun Kwan University, Journal of nature science. 45:15-34.
Li G, Kwon SW, Choi YM and Park YJ. (2011). Genetic diversity analysis of mungbean accessions from east and central Asia using SSR markers. Journal of the Korean Society of International Agriculture. 23:185-193.
Liu K and Muse SV. (2005). PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 21:2128-2129. [https://doi.org/10.1093/bioinformatics/bti282]
Moon BC, Kim WJ, Ji YU, Lee YM and Kim HK. (2013). Genetic diversity of Curcuma genus collected germplasm using analysis of AFLP. Korean Journal of Medicinal Crop Science. 21:455-460. [https://doi.org/10.7783/KJMCS.2013.21.6.455]
Oh SY. (1981). A review of the family Campanulaceae of Korea. Research Review of Kyungpook National University. 31:311-386.
Park KC, Kim YG, Hwangbo K, Gil J, Chung H, Park SG, Hong CP and Lee Y. (2017). Development of simple sequence repeat markers from Adenophora triphylla var. japonica(Regel) H. Hara using next generation sequencing. Korean Journal of Medicinal Crop Science. 25:411-417. [https://doi.org/10.7783/KJMCS.2017.25.6.411]
Park SI, Kim SR, Gil JS, Lee Y, Kim HB, Lee JH, Kim SC, Jung CS and Um Y. (2016). Development of chloroplast DNA-based simple sequence repeat markers for Angelica species differentiation. Korean Journal of Medicinal Crop Science. 24:317-322. [https://doi.org/10.7783/KJMCS.2016.24.4.317]
Peng J, Shi C, Wang D, Li S, Zhao S, Zhao X, Duan A, Cai N and He C. (2021). Genetic diversity and population structure of the medicinal plant Docynia delavayi(Franch.) Schneid revealed by transcriptome-based SSR markers. Plants Journal of Applied Research on Medicinal and Aromatic Plants. 21:100294. [https://doi.org/10.1016/j.jarmap.2021.100294]
Song JY, Lee GA, Yoon MS, Ma KH, Choi YM, Lee JR, Park HJ and Lee MC. (2012). Development and characterization of 22 polymorphic microsatellite markers for the balloon flower Platycodon grandiflorum(Campanulaceae). Genetics and Molecular Research. 11:3263-3266. [https://doi.org/10.4238/2012.September.12.9]
Um Y, Jin ML, Kim OT, Kim YC, Kim SC, Cha SW, Chung KW, Kim S, Chung CM and Lee Y. (2016). Identification of Korean ginseng(Panax ginseng) cultivars using simple sequence repeat markers. Plant Breeding and Biotechnology. 4:71-78. [https://doi.org/10.9787/PBB.2016.4.1.71]
Yang YJ. (2008). Anti-inflammatory effects of natural Adenophora triphylla var. japonica Hara water extracts. Department of Alternative Medicine, Master Degree Thesis, Chosun University, Korea. p.16-21.
Yoo KO. (1995). Taxonomic studies on the Korean Campanulaceae. Department of Biology, Ph.D Thesis, Kangwon National University, Korea. p.220-245.
Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW and Zalapa JE. (2011). Mining and validation of pyrosequenced simple sequence repeats(SSRs) from American cranberry(Vaccinium macrocarpon Ait.). Theoretical and Applied Genetics. 124:87-96. [https://doi.org/10.1007/s00122-011-1689-2]

Table 1.

Collection of A. triphylla (Thunb.) A. DC. accessions from different in Korea.

Collection Numbers	Sample name	Collection site			Coordinate		Altitudes (m)
Collection Numbers	Sample name	State	City	Town	North latitude	East longitude	Altitudes (m)
1	ES-ade#1-1	Chungcheongbuk	Chungju	Hwaan-li, Sinni-myeon	36°58′25.12″	127°44′34.51″	149
2	ES-ade#1-2	″	″	″	″	″	″
3	ES-ade#1-3	″	″	″	″	″	″
4	KH-ade#3-1	Incheon	Ganghwa	Gocheon-ri, Naega-myeon	37°45′04.32″	126°27′13.41″	48
5	KH-ade#3-2	″	″	″	″	″	″
6	KH-ade#3-3	″	″	″	″	″	″
7	AD-ade#3-5	Gyeongsangbuk	Andong	Jaepum-ri, Seohu-myeon	36°40′29.27″	128°35′07.33″	351
8	AD-ade#104	″	″	″	36°39′58.24″	128°35′15.47″	403
9	AD-ade#101	″	″	″	36°39′47.29″	128°34′34.39″	508
10	JC-ade#1	Chungcheongbuk	Jecheon	Susan-ri, Deoksan-myeon	35°53′15.41″	128°05′02.08″	241
11	BH-ade#05	Gyeongsangbuk	Bonghwa	Sang-ri, Jaesan-myeon	36°50′52.53″	128°55′34.83″	558
12	TA-ade#1	Chungcheongnam	Taean	Songhyeon-ri, Sowon-myeon	36°46′11.51″	126°10′11.24″	108
13	ES-ade#119	Chungcheongbuk	Chungju	Hwaan-li, Sinni-myeon	36°58′47.48″	127°44′02.35″	139
14	GS-ade-1-1	Chungcheongnam	Geumsan	Sangga-ri, Geumseong-myeon	36°07′08.44″	127°23′40.31″	213
15	GS-ade-1-2	″	″	″	″	″	″
16	GS-ade-1-3	″	″	″	″	″	″
17	GS-ade-2-1	Chungcheongnam	Geumsan	Sutong-ri, Buri-myeon	36°03′03.17″	127°35′19.25″	159
18	GS-ade-2-2	″	″	″	″	″	″
19	GS-ade-2-3	″	″	″	″	″	″
20	GS-ade-3-1	″	″	″	36°02′57.32″	127°35′01.05″	152
21	GS-ade-3-2	″	″	″	″	″	″
22	GS-ade-4-1	Chungcheongnam	Geumsan	Sangga-ri, Geumseong-myeon	36°07′16.18″	127°23′31.33″	208
23	GS-ade-4-2	″	″	″	″	″	″
24	CUL-ade-10	Gyeongsangbuk	Yeongju	Sanbeop-ri, Punggi-eup	36°52′34.41″	128°32′16.38″	209
25	CUL-ade-11	″	″	″	″	″	″
26	CUL-ade-12	″	″	″	″	″	″
27	CUL-ade-13	″	″	″	″	″	″
28	CUL-ade-18	″	″	″	″	″	″
29	CUL-ade-17	″	″	″	″	″	″
30	CUL-ade-21	″	″	″	″	″	″
31	CUL-ade-2-2	″	″	″	″	″	″
32	CUL-ade-4-1	″	″	″	″	″	″
33	CUL-ade-5	″	″	″	″	″	″
34	CUL-ade-37	″	″	″	″	″	″
35	CUL-ade-38	″	″	″	″	″	″
36	CUL-ade-39	″	″	″	″	″	″
37	CUL-ade-40	″	″	″	″	″	″
38	CUL-ade-41	″	″	″	″	″	″
39	CUL-ade-42	″	″	″	″	″	″
40	CUL-ade-43	″	″	″	″	″	″

No.	Marker¹⁾	SSR motif	Product size (bp)	GenBank accession No.	Sense primer (5′ → 3′)	Anti-sense primer (5′ → 3′)
1)Park et al., 2017.
1	Atri00021	AAAT₍₅₎	200-212	KY906106	GGGCATAGCTCTCTGCTTAGT	GACTGAAGATCTGAAGGTCACG
2	Atri00095	CCAG₍₅₎	132-164	KY906110	AACCACTGAGCTTCTTCGAG	CTTTCTCAGCTAGGTTCTCAGC
3	Atri00108	CTCA₍₅₎	200-232	KY906111	CATTGATGAGCTCTCGAACC	CAATGCCTGTAGTTTGGTCC
4	Atri00146	GCTA₍₅₎	179-203	KY906113	CATAGCTGAGCTGGTGAACAGT	ATTCATCTCCCCACCTTCAG
5	Atri00245	ACCAG₍₅₎	190-230	KY906123	CTTTTCTTTGAGTGGCGG	GCCATGAGATAAGATCTCGACC
6	Atri00959	CAA₍₇₎	176-251	KY906134	ACTATAGAAAGGCCCGGCT	GGCAAGTGATTGTGCAGAC
7	Atri01120	CCA₍₇₎	148-175	KY906135	AACTCGTCCTCACTCAAGGTAG	CTTTAGGTTGAGGCTAAGAGGG
8	Atri01490	GAG₍₇₎	180-198	KY906138	GAAACCTGTGAGTTGACGACTG	CATTGAGACGCGTACGAAG

No.	Markers	MAF¹⁾	N_G²⁾	N_A³⁾	H_E⁴⁾	H_O⁵⁾	PIC⁶⁾
1)MAF; major allele frequency, 2)NG; number of genotypes, 3)NA; number of allele, 4)HE; expected heterozygosity, 5)HO; observed heterozygosity, 6)PIC; polymorphism information content.
1	Atri00021	0.4500	14	8	0.7259	0.5500	0.6938
2	Atri00095	0.4625	13	7	0.7181	0.6000	0.6858
3	Atri00108	0.2500	22	12	0.8509	0.7500	0.8350
4	Atri00146	0.5375	16	12	0.6713	0.6250	0.6474
5	Atri00245	0.2250	32	14	0.8828	0.8250	0.8728
6	Atri00959	0.7375	8	5	0.4272	0.3500	0.3954
7	Atri01120	0.7250	10	6	0.4431	0.3000	0.4100
8	Atri01490	0.6250	16	13	0.5934	0.5250	0.5808
Mean	0.5016	16.375	9.625	0.6641	0.5656	0.6401

Table 4.

Morphological characteristics of A. triphylla (Thunb.) A. DC. accessions collected from different area in Korea.

No.	Sample name	Phyllotaxy	Leaf shape	Stem color	No.	Sample name	Phyllotaxy	Leaf shape	Stem color
1)light green, 2)purple.
1	ES-ade#1-1	whorled	lanceolate	114C¹⁾	21	GS-ade-3-2	whorled	eliptical	114C²⁾
2	ES-ade#1-2	whorled	lanceolate	114C	22	GS-ade-4-1	whorled	lanceolate	114C
3	ES-ade#1-3	whorled	lanceolate	114C	23	GS-ade-4-2	whorled	lanceolate	114C
4	KH-ade#3-1	alternate	eliptical	114C	24	CUL-ade-10	whorled	lanceolate	114C
5	KH-ade#3-2	alternate	lanceolate	114C	25	CUL-ade-11	whorled	lanceolate	114C
6	KH-ade#3-3	alternate	eliptical	114C	26	CUL-ade-12	whorled	eliptical	114C
7	AD-ade#3-5	alternate	lanceolate	114C	27	CUL-ade-13	whorled	lanceolate	114C
8	AD-ade#104	whorled	eliptical	114C	28	CUL-ade-18	whorled	eliptical	114C
9	AD-ade#101	whorled	lanceolate	114C	29	CUL-ade-17	whorled	lanceolate	64By
10	JC-ade#1	whorled	lanceolate	114C	30	CUL-ade-21	whorled	eliptical	114C
11	BH-ade#05	alternate	lanceolate	114C	31	CUL-ade-2-2	whorled	eliptical	114C
12	TA-ade#1	alternate	lanceolate	114C	32	CUL-ade-4-1	whorled	eliptical	114C
13	ES-ade#119	alternate	lanceolate	114C	33	CUL-ade-5	whorled	eliptical	114C
14	GS-ade-1-1	alternate	lanceolate	114C	34	CUL-ade-37	whorled	ovate	64B
15	GS-ade-1-2	alternate	lanceolate	114C	35	CUL-ade-38	alternate	ovate	114C
16	GS-ade-1-3	whorled	eliptical	114C	36	CUL-ade-39	whorled	lanceolate	64B
17	GS-ade-2-1	alternate	lanceolate	114C	37	CUL-ade-40	whorled	lanceolate	114C
18	GS-ade-2-2	whorled	eliptical	114C	38	CUL-ade-41	whorled	eliptical	114C
19	GS-ade-2-3	whorled	eliptical	114C	39	CUL-ade-42	whorled	ovate	64B
20	GS-ade-3-1	alternate	lanceolate	114C	40	CUL-ade-43	whorled	eliptical	114C