Journal Archive

Korean Journal of Medicinal Crop Science - Vol. 24, No. 4

[ ARTICLE ]
Korean Journal of Medicinal Crop Science - Vol. 24, No. 4, pp.317-322
Abbreviation: Korean J. Medicinal Crop Sci.
ISSN: 1225-9306 (Print) 2288-0186 (Online)
Print publication date Aug 2016
Received 30 May 2016 Revised 13 Jun 2016 Reviewed 4 Jul 2016 Reviewed 21 Jul 2016 Accepted 4 Aug 2016
DOI: https://doi.org/10.7783/KJMCS.2016.24.4.317

당귀 종판별을 위한 엽록체 기반 SSR 마커 개발
박상익**김세림**길진수**이 이**김호방***이정호****김성철*정찬식*엄유리*****,
*농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과
**충북대학교 농업생명환경대학 특용식물학과
***(주)바이오메딕 생명과학연구소
****(주)녹색식물연구소
*****국립산림과학원 산림약용자원연구소

Development of Chloroplast DNA-Based Simple Sequence Repeat Markers for Angelica Species Differentiation
Sang Ik Park**Serim Kim**Jinsu Gil**Yi Lee**Ho Bang Kim***Jung Ho Lee****Seong Cheol Kim*Chan Sik Jung*Yurry Um*****,
*Department of Herbal Crop Research, NIHHS, RDA, Eumseong 27709, Korea.
**Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea.
***Life Sciences Research Institute, Biomedic Co. Ltd., Bucheon 14548, Korea.
****Green Plant Institute, Suwon, Korea.
*****Forest Medicinal Resources Research Center, National Institute of Forest Sciecne, Yeongju 36040, Korea.
Corresponding author: +82-43-871-5665 urspower@korea.kr


© The Korean Society of Medicinal Crop Science. All rights reserved.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( http://creativecommons.org/licenses/by-nc/3.0 ) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

ABSTRACT
Background:

In the herbal medicine market, Angelica gigas, Angelica sinensis, and Angelica acutiloba are all called "Danggui" and used confusingly. We aimed to assess the genetic diversity and relationships among 14 Angelica species collected from different global seed companies. Toward this aim we developed DNA markers to differentiate the Angelica species.

Methods and Results:

A total of 14 Angelica species, A. gigas, A. acutiloba, A. sinensis, A. pachycarpa, A. hendersonii, A. arguta, A. keiskei, A. atropurpurea, A. dahurica, A. genuflexa, A. tenuissima, A. archangelica, A. taiwaniana, and A. hispanica were collected. The genetic diversity of all 14 species was analyzed by using five chloroplast DNA-based simple sequence repeat (SSR) markers and employing the DNA fragment analysis method. Each primer amplified 3 - 12 bands, with an average of 6.6 bands. Based on the genetic diversity analysis, these species were classified into specific species groups. The cluster dendrogram showed that the similarity coefficients ranged from 0.77 to 1.00.

Conclusions:

These findings could be used for further research on cultivar development by using molecular breeding techniques and for conservation of the genetic diversity of Angelica species. The analysis of polymorphic SSRs could provide an important experimental tool for examining a range of issues in plant genetics.


KeyWords: Angelica, Chloroplast DNA, Simple Sequence Repeat

서 언

당귀는 미나리과에 속하는 여러해살이 식물로 한국과 일본, 중국 등에 분포한다. 높이는 1 -2m 정도이며 줄기와 꽃이 자 줏빛이며 꽃은 산형화서로 무리지어 핀다. 한국에서는 참당귀 (Angelica gigas), 중국에서는 중국당귀 (Angelica sinensis), 일본에서는 일당귀 (Angelica acutiloba)를 재배하지만 3국에서 는 같은 용도의 한약재로 사용되고 있다 (Yu et al., 2004). 따라서 당귀를 한약재로 사용하는데 기원식물의 종이 다름에 도 불구하고 혼용하여 사용되는 사례가 빈번하게 일어나고 있 다 (Bang et al., 2002). 이러한 이유로 당귀 속 식물의 기원 정립을 위한 연구에는 형태학적 연구, 세포분류학적 연구 및 분자생물학적 연구가 꾸준히 진행되어 왔다 (Gil et al., 2016). 하지만 대부분 한약재는 가공처리 후 절편이나 분말형 태로 사용하기 때문에 기원식물을 감정할 수 있는 다양한 분 자생물학적 연구가 필요하다.

최근 개발된 분자생물학적 판별법은 형태적 및 이화학적 판 별에서의 한계를 보완하고 종판별 결과의 신뢰도를 향상시켜 종 분류 및 계통분석에 관한 연구에 널리 활용되고 있다 (Williams et al., 1990; Moon et al., 2013; Kim et al., 2014). 특히 polymerase chain reaction (PCR) 기법을 이용한 random amplified polymorphic DNA (RAPD), single nucleotide polymorphism (SNP), simple sequence repeat (SSR) 등은 소량의 DNA를 이용하여 식물의 생장과 관계없이 모든 조직에서 안정적으로 탐색할 수 있으며 비교적 적은 비 용으로 빠른 시간 안에 분석할 수 있다는 장점을 가진다 (Jo et al., 2013). 이들 중에서도 SSR을 이용하여 품종별 유전적 다양성을 분석하는 방법은 분자마커들 중 재현성이 가장 높고 분석이 비교적 쉬우며 간편하기 때문에 연구자들에게 선호도가 높다. 특히 엽록체 기반의 마커는 편부모 유전과 다양한 개체 군에서 상동영역을 증폭할 수 있다는 장점을 지니고 있다 (Wheeler et al., 2014). 선행연구자들은 SSR 마커를 활용하여 약용작물인 인삼 (Panax ginseng), 도라지 (Platycodon grandiflorum)에서 genetic diversity, phylogenetic relationship, population structure 등에 관한 결과를 보고하였다 (Um et al., 2016a, b; Song et al., 2012).

당귀 속 식물에서 분자마커를 사용하여 종식별에 대해 연구 한 사례는 ITS, RAPD, ISSR 등 (Lee et al., 2001; Liao et al., 2013; Mei et al., 2015)이 보고되어 있으며 최근 Lu 등 (2015)이 next generation sequencing (NGS)기법을 이용 하여 중국당귀 (A. sinensis)를 포함한 8종의 당귀에 대해 식 별이 가능한 SSR마커에 대한 연구가 보고되었다. 이처럼 중 국에서는 당귀가 가지는 한약재로써의 가치를 인정하고 그에 대한 연구가 활발하게 이루어지고 있지만 국내에서는 당귀에 대한 분자생물학적 연구가 미흡한 실정이다.

따라서 본 연구에서는 모본을 통해 유전되는 엽록체 DNA 를 분석하고 당귀의 종판별에 적용할 수 있는 SSR마커를 선 발하고 수집된 당귀 속 유전자원의 유전적 다양성을 분석하여 당귀 기원판별에 용이한 기초정보를 제공하고자 하였다.


재료 및 방법
1. 시료 수집 및 DNA 추출

참당귀 (Angelica gigas)를 포함한 Angelica 속 식물 14종 을 수집하여 사용하였다 (Table 1). 수집된 Angelica 속 식물 중 참당귀는 농촌진흥청 국립원예특작과학원 보유종인 ‘만추’ 를 사용하였고, 나머지 Angelica 속 식물은 미국의 종자회사인 Horizon Herbs (Williams, OR, USA) 와 유럽의 종자회사인 Plant World (Newton Abbot, England)에서 구입하여 사용하 였다. DNA 추출은 14종의 당귀 종자를 액체질소로 급랭시켜 막자사발을 이용하여 분말상태가 되도록 마쇄한 후, DNeasy Plant Mini Kit (QIAGEN GmbH, Hilden, Germany)을 이용하여 제조사가 제시한 실험방법에 따라 DNA를 추출하 였다. 추출된 DNA는 Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA) 기기를 이용하여 농도를 측정하였다. 각각의 DNA 최종농도는 멸균된 증류수를 이용하여 5 ng/㎕ 로 조정하였다.

Table 1 

Sources of the Angelica species used in this study.


No. Species Collected website Contry

1 Angelica gigas Local Korea
2 Angelica acutiloba Horizon Herbs USA
3 Angelica sinensis Horizon Herbs USA
4 Angelica pachycarpa Plant World Seeds EU
5 Angelica hendersonii Horizon Herbs USA
6 Angelica arguta Horizon Herbs USA
7 Angelica keiskei Horizon Herbs USA
8 Angelica atropurpurea Horizon Herbs USA
9 Angelica dahurica Horizon Herbs USA
10 Angelica genuflexa Horizon Herbs USA
11 Angelica tenuissima Horizon Herbs USA
12 Angelica archangelica Plant World Seeds EU
13 Angelica taiwaniana Plant World Seeds EU
14 Angelica hispanica Plant World Seeds EU

2. 엽록체 기반 SSR 마커 탐색

당귀의 엽록체 염기서열 확보를 위하여 앞서 추출한 참당 귀 DNA를 이용하였다. 염기서열 분석을 위해 Illumina paired-end 라이브러리를 제작한 후 Illumina HiSeq 2000 platform (Illumina, San Diego, CA, USA)을 이용하여 염 기서열을 얻었다. 생산된 염기서열은 CLC Genomics Workbench version 8.0. 프로그램을 통해 엽록체 DNA에 해당 하는 염기서열들을 수집하여 원형구조로 조립하였다. 참당귀 엽 록체 염기서열에서 SciRoKo version 3.4 software ( http:// kofler.or.at/bioinformatics/SciRoKo )를 이용하여 SSR 구간을 탐 색하였다 (Kofler et al., 2007).

Primer 3 프로그램을 이용하여 각 구간을 증폭시킬 수 있는 PCR 프라이머를 제작하였다. 프라이머 조건은 길이 18 - 25 bp, 온도는 48 - 60℃, G/C 비율 50% 이상으로 하였다. PCR 반응 액의 총 부피는 50㎕로서, 10 ng genomic DNA, 1 × Ex buffer, 1 μM primer, 0.2mM dNTPs, 그리고 0.5 unit Ex Taq DNA polymerase (Takara Bio, Otsu, Japan)로 반응하였다. PCR 반응은 C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA)를 이용하였다. PCR 조건은 95℃에서 5 분간 pre-denaturation한 후, 95℃ 서 45초, 55 - 60℃에서 45 초, 72℃에서 45초로 35 cycles로 수행하였고, final extention 과정은 72℃에서 10분간 반응시켰다. 증폭된 DNA 산물은 1.5% agarose gel에서 100 V로 전기영동한 후, Safe Gel Stain (Inclone, Seoul, Korea)로 염색하여 gel documentation system (Gel Doc XR + System, Bio-Rad, Hercules, CA, USA)에서 PCR증폭 산물을 확인하였다.

3. 유전적 다양성 및 유연관계 분석

당귀 속 유전자원에 대한 SSR 마커 다양성 분석은 DNA fragment 분석기법을 활용하였다. PCR 증폭된 산물을 DNA Fragment Analyzer Automated CE System (Advanced Analytical Technologies, Ankeny, IA, USA)으로 분석하였다. 분석시약은 dsDNA 905 Reagent kit (Geneer, Daejeon, Korea)를 사용하였다. 각 마커에서 PCR 증폭산물의 유무에 따 라 ‘1’과 ‘0’으로 표시하여 매트릭스로 변환하였다. 추출한 RFU 값이 2,000 이하인 증폭산물은 제외하고 분석하였다. 분 석결과는 GeneMaker software (SoftGenetics, State College, PA, USA)를 이용하여 정리하였다. 수집된 14종의 당귀속 유전 자원 간 유연관계 분석은 NTSYS-pc 2.10 프로그램 (Exeter Software, Setauket, NY, USA)을 이용하여 수행하였다. 프로그 램 내 옵션을 SIMQUAL로 설정하여 수행하였고 UPGMA 알고리즘을 통해 도출된 데이터를 바탕으로 SHAN 클러스터 링을 거쳐 유전적 유연관계를 분석하였다.


결과 및 고찰
1. 당귀 엽록체 DNA분석을 통한 SSR 마커 개발

참당귀 (Angelica gigas)의 엽록체 DNA 염기서열을 이용하 여 SciRoKo 분석 프로그램을 통하여 SSR 마커를 선발하였다 . 선발된 5개의 SSR 마커의 특성에 대해 Table 2에 정리하였 다. 본 연구에서 선발된 AGcpSSR1-AGcpSSR5는 모두 염기 서열 A와 T로 구성되어 있었다. SSR motif를 검토한 결과 mono-nucleotide motif는 존재하지 않았고 di-nucleotide motif 가 2개 (AGcpSSR2, AGcpSSR5), trtra-nucleotide motif 2개 (AGcpSSR1, AGcpSSR3), penta-nucleotide 1개 (AGcpSSR4) 로 분석되었다.

Table 2 

Summary of the 5 polymorphic SSR markers designed from chloroplast DNA region in Angelica gigas.


Primer name GenBank No. SSR loci SSR motif Primer sequence (5' → 3') Product size range (bp)

Foward primer Reverse primer

AGcpSSR1 KX268658 matK-trnK (AAAT)4 CTCGTTGCTTTTTCCCTA CTGAAAGGGAATGAATGG 223 - 240
AGcpSSR2 KX268659 trnG-trnR (AT)15 GCCTTCCAAGCTAACGAT ACCTCTGTCCTATCCATT 182 - 258
AGcpSSR3 KX268660 rpoC1 (AAAT)4 GCCCCCCCAAAAAAAAGA ATTACGGGATTCATCATTCG 162 - 193
AGcpSSR4 KX268661 trnfM (TTTTA)3 ATACAGAAAGGTAAAGGGG TGGACAGATACTTCGTGA 178 - 194
AGcpSSR5 KX268662 petA-psbJ (AT)9 TCTTCCTAGTATTCGACAC CCCACTATTCTACTATTCTC 132 - 245

선발된 5개의 마커인 AGcpSSR1, AGcpSSR2, AGcpSSR3, AGcpSSR4 그리고 AGcpSSR5를 이용하여 PCR증폭하고 Fragment AnalyzerTM Automated CE system을 활용하여 각 유전자원별 5개체씩 분석하였다 (Fig. 1). 이 분석 시스템은 SSR분석을 위하여 형광 dye가 결합된 프라이머를 제작하고 증폭산물을 만들어 형광물질의 양을 측정하던 방법에 비해 실 험단계를 축소시킬 수 있으며 실험실 내에서 빠른 시간 내에 결과물을 작성 할 수 있다는 장점이 있었다.


Fig. 1  Electropherograms generated by the polymorphic SSR markers, (A); AGcpSSR2 and (B); AGcpSSR5, using fragment analyzer CE System in 14 Angelica species.

M; 1 - 500 bp size maker, 1; Angelica archangelica, 2; Angelica taiwaniana, 3; Angelica hispanica, 4; Angelica pachycarpa, 5; Angelica hendersonii, 6; Angelica arguta, 7; Angelica keiskei, 8; Angelica atropurpurea, 9; Angelica dahurica, 10; Angelica genuflexa, 11; Angelica tenuissima, 12; Angelica gigas, 13; Angelica acutiloba, 14; Angelica sinensis.



GeneMaker software를 이용하여 각각의 마커들에 PCR fragment analyzer 분석 결과를 Table 3에서 정리하였다. 각 마커별 주요 위치에서 증폭되는 allele이 나타나는 빈도수 (major allele frequency, MAF)를 분석한 결과 0.50이상의 값 을 가지는 마커는 AGcpSSR2와 AGcpSSR5였다. 그리고 다형 성을 보이는 마커에서 allele의 수 (NA)를 분석한 결과 AGcpSSR1은 3개, AGcpSSR2는 10개, AGcpSSR3은 5개, AGcpSSR4는 3개, AGcpSSR5는 12개의 allele이 있는 것으 로 나타났다. 따라서 본 연구에서 개발된 당귀 엽록체 기반 SSR 마커에서는 총 33개의 allele이 출현하였고 평균적으로 6.6개의 allele이 나타나는 것으로 분석되었다.

Table 3 

Characteristics of 5 polymorphic SSR loci from Angelica gigas.


Primer name MAF NA HE No HO PIC

AGcpSSR1 0.80 3 0.34 70.0 0.00 0.31
AGcpSSR2 0.22 10 0.86 68.0 0.00 0.84
AGcpSSR3 0.55 5 0.64 66.0 0.00 0.60
AGcpSSR4 0.90 3 0.33 51.0 0.00 0.31
AGcpSSR5 0.18 12 0.89 68.0 0.56 0.88
Mean 0.51 6.6 0.61 64.6 0.11 0.59
MAF; Major allele frequency, NA; Number of alleles, HE; Expected heterozygosity, No; Number of observed (%), HO; Oserved heterozygosity, PIC; Polymorphism information content.

Expected heterozygosity (HE)는 예상이형접합도라고 하여 전체 개체 중에서 이형접합을 보일 것으로 예상되는 개체 의 비율을 뜻하는데 AGcpSSR5 > AGcpSSR2 > AGcpSSR3 > AGcpSSR1 > AGcpSSR4 순으로 분석되었다. 전체적인 HE 분석값은 0.33에서 0.89를 나타냈다. 전체 샘플 중에서 PCR 분석되어 genotyping이 가능한 시료의 비율을 의미하는 number of observed (No)는 최저 51%에서 최대 70%로 평균 64.6%의 확률을 보였다. 분석한 샘플 중에서 이형접합성을 보 이는 샘플의 비율을 나타내는 oserved heterozygosity (HO)값은 AGcpSSR5에서만 0.56으로 분석되었다. 다양성 요소인 polymorphism information content (PIC) 평균값은 0.59이며 0.31에서 0.88사이의 값을 나타냈는데 Kim 등 (2016)에 의하면 PIC값이 0.5이상이면 다형성 분석에 유익한 마커라고 보고된 바 있으며 보고된 연구결과에 따르면 인삼과 감초의 SSR마커에서 도 PIC값이 0.5이상인 마커에서 종 및 품종의 다형성 분석에 유익한 마커임을 증명한 바 있다 (Um et al., 2016a, b). 비록 AGcpSSR1과 AGcpSSR4의 PIC값이 0.31로 분석되었지만 본 연구에서 개발된 마커들을 이용하여 당귀 속 식물들의 유전적 다양성을 분석하기에 충분하였다.

2. 계통도 작성을 통한 14종 당귀의 유연관계 분석

각 마커들을 이용하여 나온 분석결과를 이용해 Fig. 2과 같 이 계통도를 작성하고 유연관계를 분석하였다. 그 결과 A. archangelicaA. taiwaniana는 상관계수 값이 1을 나타내면서 본 연구에서 쓰인 마커로 분석하였을 때 유전적 다양성이 유사 하다는 결과를 얻을 수 있었다. 마찬가지로 A. hispanicaA. pachycarpa 또한 동일한 유전자 패턴을 가지는 것으로 나 타났다. 이와는 대조적으로 A. tenuissima의 경우 5개체 모두 다른 유전자형을 나타내며 가장 가까운 유전자형의 상관계수 가 0.938로 분석되었다.


Fig. 2  A UPGMA tree based on genetic distances analyzed using 5 polymorphic SSR markers in 14 of Angelica species.


국내에서 혼용되는 참당귀 (A. gigas), 중국당귀 (A. sinensis), 일당귀 (A. acutiloba)는 계통도 분석 결과 참당귀와 일당귀의 상관계수가 0.868, 이 두 그룹과 중국당귀의 상관계수는 0.792 로 나타났다. Liao 등 (2013)에 따르면 ITS 영역 염기서열 분 석을 통해 A. dahuricaA. genuflexaA. gigasAngelica s.s. clade로 분류되었으며 A. keiskei는 littoral Angelica clade, A. arguta는 북아메리카 Angelica clade, A. acutilobaArchangelica, A. sinensisSinodielsia clade로 분류하였다. 이처럼 참당귀와 중국당귀, 일당귀는 선행연구자들에 의해 유 전적 차이가 큰 것으로 입증되어 왔을 뿐만 아니라 본 연구 결과에서도 큰 차이가 있음을 확인 할 수 있었다.

엽록체에 관한 연구는 식물 유전체학에서 생물학적 진화분 야에서 주로 연구되어 왔다 (Palmer et al., 1988). 특히 엽록 체 DNA 정보를 이용하여 종간 생체시스템상의 문제들을 해 결하기 위해 주로 활용되어 왔다 (Olmstead and Palmer, 1994). 엽록체 DNA는 대부분 모본으로부터 다음 세대로 전해 지기 때문에 유전체 수준의 연구와는 다른 특성을 가진다고 하였다 (Corriveau and Coleman, 1988; Birky et al., 1989). 유전적 다양성의 원인은 교잡으로 인한 변이가 주된 요인으로 써 엽록체 DNA는 전체 유전체에 비해 오랜 시간이 걸리는 특성 때문에 세대가 거듭되어도 비교적 장기적으로 유지된다 는 장점이 있다 (Powell et al., 1995). 그렇기 때문에 선행연 구자들은 쑥류, 삼나무에서 엽록체 DNA 기반의 SSR 마커를 이용하여 연구결과를 보고하였다 (Liu et al., 2013; Hirao et al., 2009). 또한 엽록체의 DNA 염기서열을 바탕으로 개발된 마커를 이용하여 계통분리를 하는 경우 모본의 유전적 특성 에 따라 분류할 수 있다고 하였다 (Wheeler et al., 2014). 본 연구에서는 개발된 5개의 엽록체 DNA기반 당귀 SSR마 커를 이용하여 14종의 당귀 속 식물들의 유연관계를 분석하 였다. 이를 통하여 한약재 시장에서 유통되는 당귀 속 식물 의 혼 • 오용을 방지하고 이들에 대한 기원을 재정립할 수 있 으며 차후 당귀의 분자육종을 위한 선발마커로의 활용을 기 대하는 바이다.


감사의 글

본 연구는 농촌진흥청 연구사업(과제번호: PJ01102202)의 지 원에 의해 이루어진 결과로 이에 감사드립니다.


References
1. Bang, KH, Yu, HS, Koo, DH, Cho, JH, Park, HW, Seong, NS, Park, SI, Kim, HS, Selection of RAPD marker to discrimination the bolting-resistant varieties and commercial dried medicinal materials ofAngelicaspecies, Korean Journal of Medicinal Crop Science, (2002), 10, p46-50.
2. Birky, CW Jr, Fuerst, P, Maruhama, T, Organelle gene diversity under migration, mutation and drift Equilibrium expectations, approach to equilibrium, effects of heteroplasmic cells, and comparison to nuclear genes, Genetics, (1989), 121, p613-627.
3. Corriveau, JL, Coleman, AW, Rapid screening methods to detect potential biparental inheritance of plastid DNA and results of over 200 angiosperm species, American Journal of Botany, (1988), 75, p1443-1458.
4. Gil, J, Park, SI, Lee, Y, Kim, HB, Kim, SC, Kim, OT, Cha, SW, Jung, CS, Um, Y, Current status and prospects of the authentication ofAngelicaspecies, Journal of Plant Biotechnology, (2016), 43, p151-156.
5. Hirao, T, Watanabe, A, Kurita, M, Kondo, T, Takata, K, A frameshift mutation of the chloroplast matK coding region is associated with chlorophyll deficiency in theCryptomeria japonicavirescent mutant Wogon-Sugi, Current Genetics, (2009), 55, p311-321.
6. Jo, IH, Bang, KH, Kim, YC, Kim, JU, Shin, MR, Moon, JY, Noh, BS, Hyun, DY, Kim, DH, Cha, SW, Kim, HS, Analysis of mitochondrial DNA sequence and molecular marker development for identification ofPanaxspecies, Korean Journal of Medicinal Crop Science, (2013), 21, p91-96.
7. Kim, JH, Seo, JW, Byeon, JH, Ahn, YS, Cha, SW, Cho, JH, Morphological characteristics and phylogenetic analysis ofPolygonatumspecies based on chloroplast DNA sequences, Korean of Journal Medicinal Crop Science, (2014), 22, p489-496.
8. Kim, S, Jeong, JH, Chung, H, Kim, JH, Gil, J, Yoo, J, Um, Y, Kim, OT, Kim, TD, Kim, YY, Lee, DH, Kim, HB, Lee, Y, Simple sequence repeat marker development fromCodonopsis lanceolataand genetic relation analysis, Journal of Plant Biotechnology, (2016), 43, p181-188.
9. Kofler, R, Schltterer, C, Lelley, T, SciRoKo: A new tool for whole genome microsatellite search and investigation, Bioinfomatics, (2007), 23, p1683-1685.
10. Lee, MY, Ju, YS, Kim, HJ, Ko, BS, Discrimination ofAralia continentalisroot by the random amplified polymorphic DNA analysis and morphological characteristics, Korean Journal of Oriental Medicine, (2001), 7, p145-152.
11. Liao, C, Downie, SR, Li, Q, Yu, Y, He, X, Zhou, B, New insights into the phylogeny ofAngelicaand its allies (Apiaceae) with emphasis on east asian species, inferred from nrDNA, cpDNA, and morphological evidence, Systematic Botany, (2013), 38, p266-281.
12. Liu, Y, Huo, N, Dong, L, Wang, Y, Zhang, S, Young, HA, Feng, X, Gu, YQ, Complete chloroplast genome sequences of Mongolia medicineArtemisia frigidaand phylogenetic relationships with other plants, PLoS ONE, (2013), 8, pe57533.
13. Lu, Y, Cheng, T, Zhu, T, Jiang, D, Zhou, S, Jin, L, Yuan, Q, Huang, L, Isolation and characterization of 18 polymorphic microsatellite markers for the “Female Ginseng”Angelicasinensis(Apiaceae) and cross-species amplification, Biochemical Systematics and Ecology, (2015), 61, p488-492.
14. Mei, Z, Zhang, C, Khan, A, Zhu, Y, Tania, M, Luo, P, Fu, J, Efficiency of improved RAPD and ISSR markers in assessing genetic diversity and relationships inAngelicasinensis(Oliv) Diels varieties of China, Electronic Journal of Biotechnology, (2015), 18, p96-102.
15. Moon, BC, Kim, WJ, Ji, Y, Lee, YM, Kim, HK, Genetic diversity ofCurcumagenus collected germplasm using analysis of AFLP, Korean Journal of Medicinal Crop Science, (2013), 21, p455-460.
16. Olmstead, RG, Palmer, JD, Chloroplast DNA systematics A review of methods and data analysis, American Journal of Botany, (1994), 81, p1205-1224.
17. Palmer, JD, Jansen, RK, Michaels, HJ, Chase, MW, Manhart, Jr, Chloroplast DNA variation and plant phylogeny, Annals of the Missouri Botanical Garden, (1988), 75, p1180-1206.
18. Powell, W, Morgante, M, Andre, C, McNicol, JW, Machray, GC, Doyle, JJ, Tingey, SV, Rafalski, JA, Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome, Current Biology, (1995), 5, p1023-1029.
19. Song, JY, Lee, GA, Yoon, MS, Ma, KH, Choi, YM, Lee, Jr, Park, HJ, Lee, MC, Development and characterization of 22 polymorphic microsatellite markers for the balloon flowerPlatycodon grandiflorum(Campanulaceae), Genetics and Molecular Research, (2012), 11, p3263-3266.
20. Um, Y, Jin, ML, Kim, OT, Kim, YC, Kim, SC, Cha, SW, Chung, KW, Kim, S, Chung, CM, Lee, Y, Identification of Korean ginseng(Panaxginseng) cultivars using simple sequence repeat markers, Plant Breeding and Biotechnology, (2016a), 4, p71-78.
21. Um, Y, Jin, ML, Lee, Y, Hur, M, Cha, SW, Jung, CS, Kim, SM, Lee, JH, Genetic diversity analysis of Glycyrrhiza ularensis using 8 novel polymorphic microsatellite markers, Journal of Plant Biotechnology, (2016b), 43, p174-180.
22. Wheeler, GL, Dorman, HE, Buchanan, A, Challagundla, L, Wallace, LE, A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology, Applications in Plant Sciences, (2014), 2, p1400059.
23. Williams, JGK, Kubelik, AR, Livak, KJ, Rafalski, JA, Tingey, SV, DNA polymorphisms amplified by arbitrary primers are useful as genetic markers, Nucleic Acids Research, (1990), 18, p6531-6535.
24. Yu, HS, Park, CH, Park, CG, Kim, YG, Park, HW, Seong, NS, Growth characteristics and yield of the three species of genusAngelica, Korean Journal of Medicinal Crop Science, (2004), 12, p43-46.