•

Journal Archive

Korean Journal of Medicinal Crop Science - Vol. 30 , No. 3
[Paper List] [Go to Volume List]

[ Research Articles ]
Korean Journal of Medicinal Crop Science - Vol. 30, No. 3, pp.210-216
Abbreviation: Korean J. Medicinal Crop Sci
ISSN: 1225-9306 (Print) 2288-0186 (Online)
Print publication date 30 Jun 2022
Received 24 Jan 2022 Revised 09 May 2022 Accepted 09 May 2022
DOI: https://doi.org/10.7783/KJMCS.2022.30.3.210

매실나무와 살구나무, 종간잡종의 구별을 위한 InDel 마커의 개발
김주혁1 ㆍ 이동욱2 ㆍ 김문교3, 4 ㆍ 이미선5 ㆍ 조남수6 ㆍ 이이7, †
1충북대학교 특용식물학과 석사과정생
2충북대학교 특용식물학과 학부과정생
3충북대학교 석사
4극지연구소 연구원
5충북대학교 특용식물학과 석사과정생
6충북대학교 특용식물학과 박사
7충북대학교 특용식물학과 교수

Development of InDel Markers to Distinguish between Prunus mume, Prunus armeniaca var. ansu, and their Interspecific Hybrids
Ju Hyeok Kim1 ㆍ Dong Wook Lee2 ㆍ Moon Kyo Kim3, 4 ㆍ Mi Sun Lee5 ㆍ Nam Su Jo6 ㆍ Yi Lee7, †
1Master’s student, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
2Undergraduate student, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
3Master’s degree, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
4Researcher, Korea Polar Research Institute, Incheon 21990, Korea
5Master’s student, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
6Ph. D. degree, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
7Professor, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
Correspondence to : †(Phone) +82-43-261-3373 (E-mail) leeyi22@cbnu.ac.kr


This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Funding Information ▼
ABSTRACT
Background

Prunus mume Sieb. et. Zucc. is an important medicinal resource, and its fruit is used as a health food worldwide. However, this plant is often confused with Prunus armeniaca var. ansu., a related but distinct deciduous species. To distinguish between these plants, we developed co-dominant insertion-deletion (InDel) markers.

Methods and Results

DNA was extracted from P. mume and P. armeniaca leaves and subjected to next-generation sequencing (NGS) analysis. After assembly, 30 polymorphic loci were identified. Primers were designed for the polymorphic loci and used to genotype P. mume and P. armeniaca. Using two InDel markers developed from the polymorphic loci, we distinguished between P. mume and P. armeniaca, and also identified the genetic hybrids between P. mume and P. armeniaca.

Conclusions

The two markers developed in this study can be used to authenticate P. mume, P. armeniaca, and their hybrids.

KeyWords: Prunus mume, Prunus armeniaca var. ansu, Genotyping, Insertion-Deletion, Next-Generation Sequencing
서 언

매실나무의 학명은 Prunus mume Sieb. et Zucc.로 장미과이며 낙엽활엽교목에 속한다. 매실나무의 핵과를 매실이라 부르며 원산지는 중국 사천성으로 알려져 있으며 한국, 중국 및 일본 등에 널리 분포하고 있다. 또한, 국내에서 생산된 매실은 구연산의 함량이 높은 것으로 알려져 있다 (Paik et al., 2010).

매실은 succinic acid, citric acid, malic acid 등 유기산을 포함하여 sitosterol과 같은 무기질을 함유하고 있다 (Park, 1998). 소화불량 해소, 피로 회복, 해열 작용 등이 있으며 vitamin C가 풍부해 3,000 년 전부터 건강보조 식품이나 약재로도 많이 사용되어왔다. 특히, 2015년에는 한 해 동안 2,829 톤의 매실이 농축액, 매실 절임, 매실주 등 많은 방법으로 가공되어 이용되었으며 간 기능 개선, 성인병 예방, 변비 예방 등 다양한 효능이 있다는 사실이 보고되었다 (Choi and Koh, 2015).

살구나무의 학명은 Prunus armeniaca var. ansu이며 장미과에 속하는 낙엽성 교목이다. 원산지는 동아시아이며 국내를 포함하여 중국, 일본, 유럽 등 넓게 분포되어 있다 (Yoo et al., 2007). 살구는 vitamin A의 전구체인 β-carotene 성분을 함유하고 있어 눈 건강에 효과가 있으며 항산화 성분이 풍부하여 노화예방에도 효과적이다. 또한 독특한 향이 있어 생과로 이용되거나 통조림, 잼, 건과 등으로 가공되어 이용하기도 하며 종자의 핵은 행인이라고 하여 한방에서는 진해 거담약으로 널리 이용되고 있다 (Kwon et al., 1990).

매실나무와 살구나무 등 장미과의 식물은 주로 농축액을 이용해 천연보존제로 사용하는 추출물을 활용한 연구 (Park., 1998; Sim et al., 2002; Choi and Koh, 2015)와 분자 생물학적으로 동위효소를 이용해 Prunus 속의 구분을 8 개의 종으로 분류하는 계통학적 연구가 진행되었다 (Tao et al., 2000; Tao et al., 2002; Gao, 2004).

식물체 내의 엽록체 DNA는 미토콘드리아와 더불어 식물에서 주로 모계 유전을 하는 유전체로 알려져 있다. 또한 핵 DNA에 비해 진화 속도가 느려 엽록체 DNA의 다형성 구간을 이용하여 다양한 종의 판별 연구가 진행되고 있다 (Pan et al., 2012; Park et al., 2018; Park et al., 2019). 하지만 모계유전을 하는 엽록체나 미토콘드리아에 기반한 마커는 잡종이 모계 종으로 동정이 될 수 있고 계통학적 관계를 왜곡시킬 수 있는 단점이 있어 핵 DNA의 양친 유래 마커와 함께 보완한다면 이러한 단점을 보완할 수 있을 것으로 보인다 (Lee et al., 2015).

Next-generation sequencing (NGS)은 대용량의 염기서열 정보를 빠르고 정확하게 적은 비용으로 분석할 수 있는 기술이다. 또한 이를 활용한 새로운 기술이 발전함에 따라 염기서열 정보 생성 속도와 규모가 증가했으며 분자마커 개발이 크게 가속화되었다 (Lv et al., 2016). 이러한 NGS 기술을 바탕으로 엽록체 게놈과 핵 게놈을 이용한 분자 마커 개발은 농업에서 품종을 식별하거나 종간 유전적 관계를 밝히는데 유용한 도구로 사용된다 (Daniell et al., 2016; Park et al., 2017).

식물체에서 DNA 분자 마커에 대한 연구로는 insertion-deletion (InDel) 마커를 이용한 국내 대추 품종의 구분 (Kim et al., 2021), single nucleotide polymorphism (SNP) 마커를 이용하여 토마토 품종들의 유전적 다양성 분석을 실시하거나 (Corrado et al., 2013), simple sequence repeat (SSR) 마커를 이용하여 참당귀의 유전적 다양성을 분석한 예가 있다 (Jeong et al., 2019).

하지만 SNP 마커는 분석을 위해 소모되는 비용이 많이 필요로 하여 실험실 내에서 수행하기에는 한계가 있으며, SSR 마커는 다형성이 풍부하여 품종 판별 마커 및 유전적 다양성 분석에 사용되지만 숙련된 기술력이 필요하다는 단점이 존재한다 (Gil et al., 2017; Sohn et al., 2017; Chun et al., 2019). InDel 마커는 이에 비해 표준이 되는 유전체와 증폭 결과를 비교해 크기의 차이로 간단하게 분석할 수 있다는 장점이 있다 (Chun et al., 2019).

매실나무와 살구나무 열매의 수확시기를 살펴보면, 매실은 미성숙 과실 상태에서 수확하고 살구는 성숙한 상태에서 수확하지만, 미성숙 상태의 살구는 매실과의 구분이 쉽지 않아 종종 유통, 판매에서 혼란을 일으킨다. 두 종은 계통학적으로 매우 가깝고 같은 벚나무 속으로 교잡에 의한 잡종발생이 쉽게 일어난다 (Xue et al., 2019), 잡종의 경우 풍후, 앵숙, 백가하 등 다양한 품종들이 있으며, 이 식물들은 병해충방제법이 다르기 때문에 매실나무, 살구나무들과 구분하지 않고 오용 시, 수확이 어려워 경제적 손실을 가져올 수 있다. 따라서 매실나무와 살구나무 그리고 잡종을 구분하는 연구가 필요한 시점이다.

본 연구는 국내에서 재배되고 있는 매실나무와 살구나무에서 NGS 기술을 이용하여 획득한 엽록체 및 핵 염기서열을 토대로 InDel 마커를 개발하여 매실나무와 살구나무의 구분을 명확히 하고자 하였다.

재료 및 방법
1. 실험 재료

본 실험에서 사용한 재료들은 국내 6 지역 (청주, 강릉, 과천, 함양, 영천, 부여) 에서 재배되고 있는 매실나무 (P. mume Sieb. et Zucc.)와 살구나무 (P. armeniaca var. ansu)의 어린 잎을 채취하여 매실나무 25 개체, 살구나무 6 개체 등 총 31 개체를 사용하였다. 이 중 Pm-1과 Pa-1은 건조표본으로 제작하여 Korea Medicinal Resources Herbarium (KMRH)에 기탁하였다 (Table 1).

Table 1. 
List of collected genetic resources of 25 P. mume and 6 P. armeniaca in Korea.
No. Sample name Collection date Collection area
1 Pm1)-1 Apr. 17, 2021 Cheongju, 36°37'47"N 127°27'07"E, MPS006523 (Voucher No. KMRH3))
2 Pm-2 Apr. 17, 2021 Cheongju, 36°37'47"N 127°27'06"E
3 Pm-3 Apr. 17, 2021 Cheongju, 36°37'46"N 127°27'17"E
4 Pm-4 Apr. 18, 2021 Cheongju, 36°38'02"N 127°24'43"E
5 Pm-5 Apr. 20, 2021 Gangneung, 37°46'53"N 128°52'03"E
6 Pm-6 Apr. 20, 2021 Gangneung, 37°46'53"N 128°52'03"E
7 Pm-7 Apr. 20, 2021 Gangneung, 37°42'56"N 128°53'13"E
8 Pm-8 Apr. 20, 2021 Gangneung, 37°42'56"N 128°53'13"E
9 Pm-9 Apr. 23, 2021 Cheongju, 36°39'19"N 127°35'44"E
10 Pm-10 Apr. 23, 2021 Cheongju, 36°39'19"N 127°35'44"E
11 Pm-11 Apr. 23, 2021 Cheongju, 36°39'20"N 127°35'44"E
12 Pm-12 Apr. 23, 2021 Cheongju, 36°38'35"N 127°25'27"E
13 Pm-13 Apr. 23, 2021 Cheongju, 36°38'34"N 127°25'30"E
14 Pm-14 Apr. 23, 2021 Cheongju, 36°38'35"N 127°25'30"E
15 Pm-15 May 26, 2021 Cheongju, 36°37'47"N 127°27'17"E
16 Pm-16 May 26, 2021 Cheongju, 36°37'47"N 127°27'17"E
17 Pm-17 May 27, 2021 Gwacheon, 37°27'34"N 127°01'53"E
18 Pm-18 May 27, 2021 Gwacheon, 37°27'34"N 127°01'53"E
19 Pm-19 May 27, 2021 Gwacheon, 37°27'34"N 127°01'53"E
20 Pm-20 May 27, 2021 Gwacheon, 37°27'34"N 127°01'53"E
21 Pm-21 May 27, 2021 Gwacheon, 37°27'34"N 127°01'53"E
22 Pm-22 Jun. 23, 2021 Hamyang, 35°40'40"N 127°46'12"E
23 Pm-23 Jun. 23, 2021 Hamyang, 35°40'40"N 127°46'11"E
24 Pm-24 Jun. 3, 2021 Yeongcheon, 36°00'26"N 129°03'04"E
25 Pm-25 Jul. 4, 2021 Buyeo, 36°16'15"N 126°54'37"E
26 Pa2)-1 Apr. 17, 2021 Cheongju, 36°37'46"N 127°27'06"E, MPS006524-1 (Voucher No. KMRH)
27 Pa-2 Apr. 17, 2021 Cheongju, 36°37'46"N 127°27'06"E
28 Pa-3 Apr. 17, 2021 Cheongju, 36°37'47"N 127°27'05"E
29 Pa-4 Apr. 19, 2021 Cheongju, 36°37'45"N 127°27'27"E
30 Pa-5 May 31, 2021 Cheongju, 36°37'46"N 127°27'08"E
31 Pa-6 May 31, 2021 Cheongju, 36°37'44"N 127°27'26"E
1)Pm; P. mume, 2)Pa; P. armeniaca var. ansu, 3)KMRH; Korea Medicinal Resources Herbarium.

2. DNA 추출

매실나무와 살구나무 31 개체의 DNA 추출은 Biomedic® Plant gDNA Extraction Kit (Biomedic® Co., Ltd., Bucheon, Korea)를 사용하여 수행하였다.

매실나무와 살구나무의 잎을 액체질소로 급냉시켜 막자사발을 이용하여 분말상태가 되도록 분쇄한 후 각각 20 ㎎ 씩 1.5 ㎖ tube에 넣었다. 분말 시료에 BDE buffer 400㎕와 proteinase K을 20 ㎕ 넣고 vortexing 하여 섞은 후 56℃의 항온수조에서 15 분간 처리하였다. 여기에 다시 RNase A solution 4 ㎕를 넣고 voltexing 하여 상온에서 2 분간 처리한 후, BDB buffer 400 ㎕ 넣고 vortexing하여 준비된 혼합물을 spin column에 넣고 8,000 rpm에서 1 분간 원심 분리하였다. 통과된 용액은 버리고 column에 새로운 collection tube를 끼운 후 700 ㎕의 buffer BWB1을 넣고 8,000 rpm에서 1 분간 원심분리하였다. 통과된 용액은 버리고 column에 새로운 collection tube를 끼운 후 500 ㎕의 buffer BWB2를 넣고 14,000 rpm에서 3 분간 원심분리하였다. 깨끗한 1.5 ㎖ tube에 column을 끼워준 후 EB buffer 100 ㎕ 넣고 실온에서 2분간 정치 후 8,000 rpm에 2 분간 원심분리하여 DNA를 회수하였다.

추출된 DNA는 DeNovix® DS-11+ spectrophotometer (DeNovix Inc., Wilmington, DE, USA) 기기를 이용하여 농도를 측정하였다. 각각의 DNA 최종 농도는 EB buffer를 이용하여 10 ng/㎕로 조정하였다. 사용할 때까지 -20℃의 냉동고에 보관하였다.

3. NGS 분석

Biomedic Plant gDNA Extraction Kit를 사용하여 매실나무와 살구나무의 염기서열 분석을 위한 Pm-1과 Pa-1의 DNA를 추출하였다. 이를 통해 library로 제작하여 Illumina Hi-Seq 2500 Platform (Illumina Inc., San Diego, CA, USA)을 이용하여 NGS를 수행하였다.

4. InDel 구간 탐색 및 primer 제작

확보한 Pm-1과 Pa-1의 염기서열을 CLC Genomics Workbench ver. 20.0 (Qiagen, Aarhus, Denmark) 프로그램을 이용해 read들을 trimming 과정을 통해 품질을 높인 후, assembly 과정을 통해 contig를 작성하였다. 각 contig들을 비교하여 다형성을 보이는 InDel 구간을 탐색하였다. primer는 InDel부분을 포함하는 정방향 primer와 역방향 primer를 각각 디자인하여 primer 제작을 의뢰(Bionics Co., Ltd., Seoul, Korea)하였다.

Primer 제작의 조건은 길이 18 bp - 22 bp, annealing 온도는 48℃ - 60℃, GC content 비율은 30% - 60%, product size는 150 bp - 400 bp로 하였다.

5. PCR (polymerase chain reaction)

PCR에 사용된 혼합 용액의 조성은 gDNA 1 ㎕, 5 uM 농도의 forward primer와 reverse primer 각각 1 ㎕, 2 × Taq mix 10 ㎕, 3차 증류수 7 ㎕를 첨가하여 총 20 ㎕으로 하였고, T100TM Thermal Cycler (Bio-Rad Inc., Hercules, CA, USA)를 사용하여 증폭하였다.

PCR 조건은 95℃에서 pre-denaturation 3 분을 수행한 후, 95℃에서 denaturation 30 초, 55.5℃와 57.0℃에서 각각 annealing 30 초, 72℃에서 extension 1 분 과정을 1 cycle로 하여 35 cycles 반복하였다. 72℃에서 final extention 5 분간 실시하였다. PCR 산물은 –20℃에 보관하였다.

6. 전기영동

PCR 증폭산물의 유전자형을 확인하기 위해 전기영동을 실시하였다. 사용된 gel은 1 × TAE buffer 100 ㎖,에 3 g 의 agarose를 첨가하여 3 %의 농도로 하였고 30 분 동안 굳혀 제작하였다. 시각화를 위한 DNA 염색은 EtBr (ethidium bromide)을 사용하였다.

Agarose gel의 각 줄의 첫 번째 lane마다 1 kb ladder plus (Dongsheng Biotech Co., Ltd., Guangzhou, China)를 4 ㎕씩 넣어 유전자형의 크기를 확인할 수 있도록 하였다. Mini Sub-cell GT (Bio-Rad Inc., Hercules, CA, USA)를 사용하여 120 V로 30 분간 전기영동을 진행하였으며 Gel DocTM XR+ System (Bio-Rad Inc., Hercules, CA, USA)을 이용하여 밴드를 시각적으로 분석하였다.

결 과
1. NGS 및 InDel 구간 탐색 결과

NGS 분석 결과 매실나무 (Prunus mume Sieb. et Zucc.) Pm-1의 전체 read의 크기는 11,455,722,512 bp이며 전체 read 수는 75,865,712개로 나타났다. 또한 GC content는 39.18%, AT content은 60.82%였다. 살구나무 (Prunus armeniaca var. ansu) Pa-1의 전체 read의 크기는 12,989,569,338 bp였으며 전체 read 수는 86,023,638 개로 나타났다. GC content는 39.49%, AT content은 60.51%로 나타났다.

CLC Genomics Workbench ver. 20.0 프로그램 (Qiagen, Aarhus, Denmark)을 이용하여 assembly를 통해 조립된 contig를 이용하여 핵과 엽록체의 염기서열에서 매실나무와 살구나무의 비교 분석을 통해 다형성을 보이는 InDel 구간을 탐색하였다 (Fig. 1). 핵 염기서열에서 20 개와 엽록체 염기서열에서 10 개의 다형성 구간을 발굴하고 InDel 마커 후보를 위한 정방향, 역방향 primer를 제작하였다.


Fig. 1.  Indel locus sequences of developed markers.

A; CP-InDel-8, B; NC-InDel-19.



제작된 primer set가 정상적으로 증폭되는지 여부와 유전자형을 관찰하기 위해 PCR 분석을 진행하였고, 전기영동을 통해 다형성을 분석하였다. 전기영동 genotyping 결과 InDel 마커를 선별하였고, 엽록체 DNA를 기반으로 만든 CP-InDel-8과 핵 DNA를 기반으로 만든 NC-InDel-19를 개발하였다 (Table 2).

Table 2. 
Primer information of the InDel markers for the distinguishment of P. mume and P. armeniaca.
Primer name Accession number Primer sequence (5' → 3') Amplicon size
(bp)		 Annealing temperature
(℃)
CP-InDel-8 ON239741 F1) : TTCCAACCGTAACATTTTTG 229, 249 57.0
R2) : TCGTCGAGATTGAAGGAGTT
NC-InDel-19 ON239740 F : GGTATGTTTTGCGCCATT 200, 294 55.5
R : CTTGCATACCTTTCACCT
1)F; foward primer, 2)R; reverse primer

2. 개발된 InDel 마커를 이용한 genotyping

엽록체 DNA에 기반한 CP-InDel-8 마커를 이용하여 수집한 31 개의 샘플을 genotyping한 결과, 25 개의 매실나무 샘플 중 16 개 (Pm-1, Pm-4, Pm-5, Pm-6, Pm-7, Pm-8, Pm-11, Pm-12, Pm-13, Pm-14, Pm-17, Pm-18, Pm-21, Pm-22, Pm-23, Pm-24)에서 229 bp의 밴드가 검출되었으며, 6 개의 살구나무 샘플 (Pa-1, Pa-2, Pa-3, Pa-4, Pa-5, Pa-6)에서는 249 bp의 밴드가 나타나 매실나무와 살구나무를 구별할 수 있었다. 그러나 매실나무 25 개의 샘플 중 9 개 (Pm-2, Pm-3, Pm-9, Pm-10, Pm-15, Pm-16, Pm-19, Pm-20, Pm-25)는 살구나무와 같은 249 bp로 밴드가 나타나 매실나무로 수집되었음에도 불구하고 살구나무의 유전자형을 보였다 (Fig. 2A).


Fig. 2.  Results of electrophoresis performed on 31 genetic resources using two InDel markers

A; result of CP-InDel-8 marker, B; result of NC-InDel-19 marker. 1; Pm-1, 2; Pm-2, 3; Pm-3, 4; Pm-4, 5; Pm-5. 6; Pm-6, 7; Pm-7, 8; Pm-8, 9; Pm-9, 10; Pm-10, 11; Pm-11, 12; Pm-12, 13; Pm-13, 14; Pm-14, 15; Pm-15, 16; Pm-16, 17; Pm-17, 18; Pm-18, 19; Pm-19, 20; Pm-20, 21; Pm-21, 22; Pm-22, 23; Pm-23, 24; Pm-24, 25; Pm-25, 26; Pa-1, 27; Pa-2, 28; Pa-3, 29; Pa-4, 30; Pa-5, 31; Pa-6. Pm; Prunus mume, Pa; Prunus armeniaca.



핵 DNA에 기반한 NC-InDel-19 마커를 이용하여 31 개의 샘플을 genotyping한 결과, 25 개의 매실나무 샘플 중 CP-InDel-8 마커를 이용하여분석한 결과 매실나무로 판명된 16 개 (Pm-1, Pm-4, Pm-5, Pm-6, Pm-7, Pm-8, Pm-11, Pm-12, Pm-13, Pm-14, Pm-17, Pm-18, Pm-21, Pm-22, Pm-23, Pm-24)는 294 bp의 밴드가 검출되었으며 6 개의 살구나무 샘플 (Pa-1, Pa-2, Pa-3, Pa-4, Pa-5, Pa-6)에서는 200 bp의 밴드가 검출되었다.

매실나무 25 개의 샘플 중 CP-InDel-8 마커를 이용하여 분석하였을 때 살구나무로 판명되었던 9 개 (Pm-2, Pm-3, Pm-9, Pm-10, Pm-15, Pm-16, Pm-19, Pm-20, Pm-25)는 200 bp와 294 bp 두 개의 밴드를 모두 가지는 유전자형을 나타냈다 (Fig. 2B).

고 찰

CP-InDel-8 마커를 사용하여 PCR 분석 결과 16 개의 매실나무 샘플은 229 bp, 6 개의 살구나무 샘플은 249 bp의 PCR 산물 크기를 나타내어 구별이 가능했으나 9 개의 매실나무 시료에서는 살구나무와 같은 유전자형을 나타내어 모든 매실나무와 살구나무를 구별하는 데에는 어려움이 있었다.

따라서 추가적인 분자마커가 필요했고, 이에 따라 염색체에 기반한 NC-InDel-19 마커를 개발 및 적용한 결과 CP-InDel-8 마커를 사용하였을 경우에 살구나무인 것으로 판명되었던 9 개의 매실나무 샘플 Pm-2, Pm-3, Pm-9, Pm-10, Pm-15, Pm-16, Pm-19, Pm-20, Pm-25에서 살구나무와 매실나무의 밴드를 모두 가지는 hetero한 유전자형을 보여 두 품종간의 잡종임을 확인하였다.

이러한 결과를 통하여 엽록체 기반 마커 CP-InDel-8를 이용한 분석에서 잡종이 모계로 동정되어 계통학적 관계가 왜곡되는 단점을 양친의 유래를 확인할 수 있는 핵 기반 마커 NC-InDel-19를 통해 보완할 수 있을 것으로 해석된다.

또한, CP-InDel-8 마커를 통해 매실나무 중 잡종이었던 개체들이 살구나무와 같은 크기의 밴드를 나타냈던 점을 고려하는 경우, 이들은 살구나무가 자방친으로 사용되고 매실나무가 화분친으로 작용할 수 있다는 보고 (Lee et al., 2015)를 입증하고 있는 것으로 해석된다.

수집된 잡종 개체들 중에는 매실나무가 모계인 것은 없었는데 이러한 결과는 매실나무와 같은 장미과 식물인 장미를 이용한 연구에서 잡종을 대상으로 genotyping을 실시한 경우에 화분친에 비해 자방친 마커의 빈도가 늘어난다는 보고를 고려하는 경우 (Kim et al., 2010), 매실나무와 살구나무의 경우에도 잡종의 경우 살구나무가 자방친으로 교배가 되었을 가능성이 높으며, 매실나무가 자방친으로 이용되어 만들어진 잡종 개체들도 존재할 것이라고 판단되어지며 이에 대해서는 추가적인 연구가 필요할 것으로 생각된다.

본 연구를 통하여 개발된 CP-InDel-8, NC-InDel-19를 이용하여 구별이 어려운 매실나무와 살구나무 및 잡종을 유전학적으로 정확하게 구별이 가능하게 함으로써 유통시장에서의 혼란을 방지할 수 있을 뿐 아니라, 분자 마커로 활용함으로써 식물의 계통학적 분석을 통한 기원학적 연구 및 새로운 매실나무나 살구나무의 품종의 개발에도 활용될 수 있을 것으로 생각된다.

Acknowledgments

본 연구는 산림청(한국임업진흥원) 산림과학기술 연구개발사업(2020203B10-2122-BA01)의 지원에 의하여 이루어진 것으로 이에 감사드립니다.

References
1. Choi BY and Koh EM. (2015). Determination of ethyl carbamate in Maesil extract and estimated daily intake. Korean Journal of Food and Cookery Science. 31:112-117.
2. Chun JB, Jin MA, Jeong NH, Cho CO, Seo MS, Choi MS, Kim DY, Sohn HB and Kim YH. (2019). Genetic identification and phylogenic analysis of new varieties and 149 Korean cultivars using 27 InDel markers selected from dense variation blocks in soybean(Glycine max (L.) Merrill). Korean Journal of Plant Resources. 32:519-542.
3. Corrado G, Piffanelli P, Caramante M, Coppola M and Rao R. (2013). SNP genotyping reveals genetic diversity between cultivated landraces and contemporary varieties of tomato. BMC Genomics. 14:835. https://link.springer.com/article/10.1186/1471-2164-14-835 (cited by 2022 Jan 3).
4. Daniell H, Lin CS, Yu M and Chang WJ. (2016). Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biology. 17:134. https://link.springer.com/article/10.1186/s13059-016-1004-2 (cited by 2022 Jan 3).
5. Gao ZH, Shen ZJ, Han ZH, Fang JG, Zhang YM and Zhang Z. (2004). Microsatellite markers and genetic diversity in Japanese apricot(Prunus mume). HortScience. 39:1571-1574.
6. Gil JS, Um Y, Byun JK, Chung JW, Lee Y and Chung CM. (2017). Genetic diversity analysis of wood-cultivated ginseng using simple sequence repeat markers. Korean Journal of Medicinal Crop Science. 25:389-396.
7. Jeong DH, Park YM, Kim KY, Park HW, Jeon KS, Kim MJ, Gil JS, Lee Y and Um Y. (2019). Genetic diversity of Angelica gigas Nakai collected in Korea using genome-wide SSR markers. Korean Journal of Medicinal Crop Science. 27:376-382.
8. Kim JK, Ahn DC, Oh HJ, Kim KH, Choi YM, Oh SY, Kang NJ, Jeong BR, Kim ZH and Park YH. (2010). Skewed inheritance of EST-SSR alleles in reciprocal crosses of cut roses. Horticultural Science and Technology. 28:618-626.
9. Kim MK, Kim JH, Lee MS, Jo NS, Park SI, Gil JS, Yeruult E, Oh HK, Lee KH, Kim HB, Lee MS and Lee Y. (2021). Development of insertion or deletion markers to distinguish Korean jujube cultivars. Korean Journal of Medicinal Crop Science. 29:282-292.
10. Kwon YJ, Kim YH, Kwak JJ, Kim GS and Yang KG. (1990). Volatile components of apricot(Prunus armeniaca var. ansu Max.) and Japanese apricot(Prunus mume Sieb. et Zucc.). Journal of Applied Biological Chemistry. 33:319-324.
11. Lee JR, Kim CS, Lee IY, Oh HJ, Kim JH and Kim SY. (2015). Identification of Korean Poaceae weeds based on DNA sequences. Weed and Turfgrass Science. 4:26-34.
12. Lv Y, Liu Y and Zhao H. (2016). mInDel: A high-throughput and efficient pipeline for genome-wide InDel marker development. BMC Genomics. 17:290. https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-016-2614-5 (cited by 2022 Jan 1).
13. Paik IY, Chang WR, Kwak YS, Cho SY and Jin HE. (2010). The effect of Prunus mume supplementation on energy substrate levels and fatigue induction factors. Journal of Life Science. 20:49-54.
14. Pan IC, Liao DC, Wu FH, Daniell H, Singh ND, Chang C, Shih MC, Chan MT and Lin CS. (2012). Complete chloroplast genome sequence of an orchid model plant candidate: Erycina pusilla apply in tropical Oncidium breeding. PloS One. 7:e34738. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0034738 (cited by 2022 Jan 1).
15. Park IK, Yang SG, Kim WJ, Noh P, Lee HO and Moon BC. (2018). The complete chloroplast genomes of six Ipomoea species and indel marker development for the discrimination of authentic Pharbitidis Semen(Seeds of I. nil or I. purpurea). Frontiers in Plant Science. 9:965. https://www.frontiersin.org/articles/10.3389/fpls.2018.00965/full (cited by 2022 Jan 1).
16. Park IK, Yang SG, Kim WJ, Song JH, Lee HS, Lee HO, Lee JH, Ahn SN and Moon BC. (2019). Sequencing and comparative analysis of the chloroplast genome of Angelica polymorpha and the development of a novel indel marker for species identification. Molecules. 24:1038. https://www.mdpi.com/1420-3049/24/6/1038 (cited by 2022 Jan 1).
17. Park SI, Hwangbo K, Gil JS, Chung H, Kim HB, Kim OT, Kim SC, Koo SC, Um Y and Lee Y. (2017). Determination of the origin of Angelica roots using Angelica gigas chloroplast based SSR markers. Korean Journal of Medicinal Crop Science. 25:361-366.
18. Park YS. (1998). Effect of Prunus mume extract on the sensory quality and shelf life of cooked rice. Korean Journal of Food and Cookery Science. 14:503-508.
19. Sim JH, Park MW, Kim MR, Yim GT and Park ST. (2002). Screening of antioxidant in Fructus Mune(Prunus mune Sieb.Et Zucc.) extract. Journal of Applied Biological Chemistry. 45:119-123.
20. Sohn HB, Kim SJ, Hwang TY, Park HM, Lee YY, Koo BC and Kim YH. (2017). Chromosome reshuffling patterns of Korean soybean cultivars using genome-wide 202 InDel Markers. Korean Journal of Breeding Science. 49:213-223.
21. Tao R, Habu T, Yamane H and Sugiura A. (2002). Characterization and cDNA cloning for Sf-RNase, a molecular marker for self-compatibility, in Japanese apricot(Prunus mume). Journal of the Japanese Society for Horticultural Science. 71:595-600.
22. Tao R, Habu T, Yamane H, Sugiura A and Iwamoto K. (2000). Molecular markers for self-compatibility in Japanese apricot (Prunus mume). HortScience. 35:1121-1123.
23. Xue S, Shi T, Luo W, Ni X, Iqbal S, Ni Z, Huang X, Yao D, Shen Z and Gao Z. (2019). Comparative analysis of the complete chloroplast genome among Prunus mume, P. armeniaca, and P. salicina. Horticulture Research. 6:89. https://academic.oup.com/hr/article/doi/10.1038/s41438-019-0171-1/6437923?login=true (cited by 2022 Jan 1).
24. Yoo SJ, Kim SH, Jun MS, Oh HT, Cho HJ and Ham SS. (2007). Antioxidative, antimutagenic and cytotoxic effects of Prunus armeniaca extracts. Korean Journal of Food Preservation. 14:220-225.
 

Bisan-ro 92, Soie-myoen, Eumseong-gun, Chungbuk 27709, Korea
TEL : 043-871-5598 / FAX : 043-871-5599 / E-mail : medcrop@hanmail.net
Copyright © The Korean Society of Medical Crop Science. All rights reserved.